Skip to main content

Table 1 Primers for PCR or sequencing

From: Safety and immunogenicity of an attenuated Chinese pseudorabies variant by dual deletion of TK&gE genes

Primer Sequence(5′- 3′) Positions
PRV ΔTK En pa F CGGTATTTACGATGCGCAGACCCGGAAGCAGAACGGCAGCGCTCACGGCCCTGCGCAACGGGATGACGACGATAAGTAGGGATAAC 59,655
PRV ΔTK En pa R GTTGACCAGCATGGCGTAGACGTTGCGCAGGGCCGTGAGCGCTGCCGTTCTGCTTCCGGGGGGTAATGCCAGTGTTACAACCA 60,081
PRV ΔTK check F CGGATCTACCTCGACGGCGCCTA 59,524
PRV ΔTK check R TTGTACGCGCCGAAGAGGGTGT /
PRV BAC H1 F GTACCCGTACACCGAGTCGT 121,170
PRV BAC H2 R TTGTGGACCCGCGCGAACAT 126,648
PRV ∆gE check F AGCCCCGGGAAGATAGCCAT 123,141
PRV ∆gE check R ATCGCGGAACCAGACGTCGAAG 125,157
PRV gD part F GGTGCGCGCACCTGCTGTACTTTA 121,385
PRV gD part R AGATGTAGACGCACACGCCCACCAG 122,191
  1. Positions indicate the position of the first base of 5′ terminal on the reference genome sequence NC_006151.1. “/” indicate the primer is not on the genome of PRV but the Kanamycin resistance mark gene