Skip to main content

Advertisement

Table 2 The primer list for reverse transcription and amplification of RT-qPCR

From: Histamine activates inflammatory response and depresses casein synthesis in mammary gland of dairy cows during SARA

Gene NCBI Accession PCR product Forward Primer (5’-3’) Reverse Primer (5′ -3’)
H1R NM_174083.4 245 bp AGCCAGAACCAGCTTGAGAT TTCATGTGCAAGCCAGACAC
H2R XM_015464941.1 198 bp TTGGCAAGGTCTTCTGCAAC GGAAGGACAGGGTGATGGAA
H3R XM_015466045.1 172 bp CAGAAGATGGTGCTGGTGTG AAGGGGTGAAGAACTCGAGG
H4R XM_001251983.5 221 bp ATCCTTGCCCTCACGTTAGT CGAAGGGATGCTGCTGATTC
IL-1β NM_174093.1 167 bp GGCCAAAGTCCCTGACCTCT CTGCCACCATCACCACATTC
TNF-α NM_173966.3 261 bp CACATACCCTGCCACAAGGC CTGGGGACTGCTCTTCCCTCT
NF-κB NM_001045868.1 129 bp ATACGTCGGCCGTGTCTAT GGAACTGTGATCCGTGTAG
mTOR XM_001788228.1 199 bp ATGCTGTCCCTGGTCCTTATG GGGTCAGAGAGTGGCCTTCAA
P70S6K NM_205816.1 162 bp GGACATGGCAGGGGTGTTT GGTATTTGCTCCTGTTACTTTTCG
4EBP1 BC120290.1 177 bp GGCAGGCAGTGAAGAGTC CCTGGGCTGCGGGAT
αS1-casein NM_181029.2 170 bp ATTTTCAGACAATTCTACCAGCT AATTCACTTGACTCCTCACCAC
GAPDH NM_001034034.2 135 bp TGTTGTGGATCTGACCTGCC AAGTCGCAGGAGACAACCTG