Skip to main content

Table 1 The primers and their applications in this study

From: Molecular characterization and expression patterns of a non-mammalian toll-like receptor gene (TLR21) in larvae ontogeny of common carp (Cyprinus carpio L.) and upon immune stimulation

Primer Sequence (5` → 3`) Application
TLR21 F1
TLR21 R1
CTACAGTTTCAGGAGTTGCA
TACGATTGTATCGATAGCTCAG
cDNA amplification
5′- GSP Outer
5′- GSP Inner
3′- GSP Outer
3′- GSP Inner
TGGCAAGCGAGTTTGGTAGACGGGTGGA
TAGACGGGTGGAGTGATGCAGGGTG
CCAGCTATCGTCTCTTTCAAGA
GCAACYGTCTACTTATCACC
RACE gene specific
primers
TLR21 F2
TLR21 R2
40S F
40S R
AAGGACCAGGAGGAGAAAT
AGAGCCGAAATGAAGAACC
CCGTGGGTGACATCGTTACA
TCAGGACATTGAACCTCACTGTCT
Real-time PCR