Skip to main content

Table 3 Sequences of primers for the PCR assay

From: Responses to dietary levels of methionine in broilers medicated or vaccinated against coccidia under Eimeria tenella-challenged condition

Genea Forward(5′-3′) Reverse(5′-3′)
IL-2 TCTTTGGCTGTATTTCGGTAG CTTTATTAATGTTTGAAGAGGTTTC
IFN-γ AGCCGCACATCAAACACAT TCACCTTCTTCACGCCATC
TNF-α CTTGGCTGTCGTGTGGTGG CGTGGGCATTGCAATTTGG
β-tubulin GCGTTATTTGACTGTGGCG GGAGCTGTTCTTGGTCTGGA
  1. aIL-2: interleukin-2; IFN-γ: interferon-γ; TNF-α: tumor necrosis factor-α