Skip to main content

Table 1 Sequences of primers used in the Luminex x-TAG assay

From: Rapid detection of three rabbit pathogens by use of the Luminex x-TAG assay

Primer Sequence Target gene Accession number Genome location Product size (bp)
RHDV-F CTCTCCACAAAATAACCCATTCACA VP60 KF494951.1 285~ 309 161
RHDV-R CCAACCCTGGTCCAATCTCG 445–426
RRV-F ATGGTTCGCTTGTGTCTTAGTTG VP4 U62152.1 303~ 325 251
RRV-R ATGCGTTGGGTGTAGTTCCTGTA 553~ 531
SV-F TGACAACAAACGGAGTAAACGC N AB753448.1 269~ 289 148
SV-R ACCATAGGTCCAAACAGCCATTC 416~ 394