Skip to main content

Table 1 Primers used to amplify the whole genomes of PCV

From: Genetic variation analysis of PCV1 strains isolated from Guangxi Province of China in 2015

Name Sequence (5’-3’) Tm(°C) Genome position Size of amplicons PCV type
PCV1-F GGTACCCGAAGGCCGATTTG 56.5 920-939 1759bp PCV 1
PCV1-R GGGTACCTCCGTGGATTGTTCT 58.5 905-926   PCV 1
PCV2-F GCCAGAATTCAACCTTAACCTTTCT 63 1430-1454 1769bp PCV 2
PCV2-R GAATTCTGGCCCTGCTCCC 61 1421-1439   PCV 2