Skip to main content

Table 1 Primer set used in the present study

From: The response of canine faecal microbiota to increased dietary protein is influenced by body condition

Target Primers (5’➔3′) References
Bacteria V3 region PRBA338f ACTCCTACGGGAGGCAGCAG [56]
PRUN518r ATTACCGCGGCTGCTGG
Total Bacteria fwd CGGYCCAGACTCCTACGGG [57]
rev TTACCGCGGCTGCTGGCA
Firmicutes fwd GGAGYATGTGGTTTAATTCGAAGCA [58]
rev AGCTGACGACAACCATGCAC
Enterobacteriaceae fwd CATTGACGTTACCCGCAGAAGAAGC [59]
rev CTCTACGAGACTCAAGCTTGC
Bacteriodetes fwd GGARCATGTGGTTTAATTCGATGAT [58]
rev AGCTGACGACAACCATGCAG
Lactobacillus fwd GGAATCTTCCACAATGGACG [60]
rev CGCTTTACGCCCAATAAATCCGG
Clostridial cluster I fwd TACCHRAGGAGGAAGCCAC [61]
rev GTTCTTCCTAATCTCTACGCAT
Clostridial cluster IV fwd ATGCAAGTCGAGCGA(G/T)G [62]
rev TATGCGGTATTAATCT(C/T)CCTTT
Clostridial cluster XIVa fwd CGGTACCTGACTAAGAAG [63]
rev AGTTT(C/T)ATTCTTGCGAAC
Butyryl-CoA acetate-CoA transferase fwd AAGGATCTCGGIRTICAYWSIGARATG) [64]
rev GAGGTCGTCICKRAAITYIGGRTGNGC
Butyrate kinase fwd TGCTGTWGTTGGWAGAGGYGGA; [65]
rev GCAACIGCYTTTTGATTTAATGCATGG