Skip to main content

Advertisement

Table 1 Primers used for nuc, mecA and virulence genes amplification

From: Prevalence and molecular characterization of Staphylococcus aureus isolated from goats in Chongqing, China

Gene Primer Primer sequence (5′to 3′) Amplification size (bp) Reference
nuc SF:GCGATTGATGGTGATACGGTT 279 [13]
SR:AGCCAAGCCTTGACGAACTAAAGC
mecA SF: AAAATCGATGGTAAAGGTTGGC 533 [15]
SR: AGTTCTGCAGTACCGGATTTGC
sea SF: GGTTATCAATGTGCGGGTGG 102 [16]
SR: CGGCACTTTTTTCTCTTCGG
seb SF: GTATGGTGGTGTAACTGAGC 164 [16]
SR: CCAAATAGTGACGAGTTAGG
sec SF: AGATGAAGTAGTTGATGTGTATGG 451 [16]
SR: CACACTTTTAGAATCAACCG
sed SF:CCAATAATAGGAGAAAATAAAAG 278 [16]
SR: ATTGGTATTTTTTTTCGTTC
see SF:AGGTTTTTTCACAGGTCATCC 209 [16]
SR: CTTTTTTTTCTTCGGTCAATC
seg SF: TGCTATCGACACACTACAACC 704 [17]
SR:CCAGATTCAAATGCAGAACC
seh SF:CGAAAGCAGAAGATTTACACG 495 [17]
SR: GACCTTTACTTATTTCGCTGTC
sei SF:GACAACAAAACTGTCGAAACTG 630 [17]
SR: CCATATTCTTTGCCTTTACCAG
sej SF: CATCAGAACTGTTGTTCCGCTAG 142 [18]
SR: CTGAATTTTACCATCAAAGGTAC
tst SF: ACCCCTGTTCCCTTATCATC 326 [16]
SR: TTTTCAGTATTTGTAACGCC
eta SF: ATATCAACGTGAGGGCTCTAGTAC 1155 [20]
SR: ATGCAGTCAGCTTCTTACTGCTA
etb SF: CACACATTACGGATAATGCAAG 604 [20]
SR: TCAACCGAATAGAGTGAACTTATCT
pvl SF: GTGCCAGACAATGAATTACCC 255 [19]
SR: TTCATGAGTTTTCCAGTTCACTTC