Skip to main content

Table 1 List of Primers

From: Gene expression analyses of the small intestine of pigs in the ex-evacuation zone of the Fukushima Daiichi Nuclear Power Plant

Gene   Primer sequences (5′ to 3′)
IFN-γ sense
antisense
GGCCATTCAAAGGAGCATGG
AGTTCACTGATGGCTTTGCG
TLR3 sense
antisense
TCACCCTGCCTAGCATTTGA
ACAAGGCAAACTCCTGCTCA
Cyclin G1 sense
antisense
CGATTCTCCTCGCCTCGTAG
CAGGGCATTCAGCTGGTGTA
AIFM1 sense
antisense
AGAGTAGCGGTTGCCGAAAT
CATGCCATCGCTGGAACAAG
EPHX2 sense
antisense
AGTCATCTGCTCCTCCCGAA
GCCCTCACTCTCTCAGGGTA
GADD45A sense
antisense
ATGCCCTCGAAGAAGTGCTC
CGCTTGGATCAGGGTGAAGT
OGG1 sense
antisense
CGTTCTGCCCCGTAGCAT
TCCTCAGTCTGGGTCAGTGT
Smad7 sense
antisense
AGAGTGGGGAGGCTCTACTG
TCTGCACCAGCTGACTCTTG
XAB2 sense
antisense
GTGCCGAGGAGTACATCGAG
TCCACGTTGAGAGACTGCAC
XPC sense
antisense
GGAAGAAGACGCACCTTCCA
TGTGTTCTCTCCCAAGCCAC
XRCC1 sense
antisense
GACCCTCCTGCGTCTTTCTG
CCAGCTGGAGAACCACAGAG