Skip to main content

Table 3 List of the primers used for the amplification of 3 overlapping fragments of 18S rDNA of piroplasms

From: First clinical case report of Cytauxzoon sp. infection in a domestic cat in France

Primer names Primers sequences Product size bp PCR conditions Reference
Nested PCR:
BTF1(external)
BTR1 (external)
GGCTCATTACAACAGTTATAG CCCAAAGACTTTGATTTCTCTC 930 bp 94 °C 3 min,
58 °C 1 min
72 °C 2 min
45 cycles:
94 °C 30s,
58 °C 20s
72 °C 30s
72 °C 7 min
[17]
BTF2 (internal)
BTR2 (internal)
CCGTGCTAATTGTAGGGCTAATAC GGACTACGACGGTATCTGATCG 836 bp Same conditions for the secondary round with an annealing temperature of 62 °C
Paraseq1F_scanelis
18seq1R_scanelis
TGGCTCATTAMAACAGTTATAGTTTA AGACAAATCRCTCCACCAAC 1188 94 °C 3 min
45 cycles:
94 °C 20 s
56 °C 30 s
72 °C 45 s
72 °C 7 min
Unpublished
Piro-A
Piro-B
AAT ACC CAA TCC TGACAC AGG G TTA AAT ACG AAT GCC CCC AAC 408 bp 94 °C 1 min
39 cycles
94 °C 45 s,
62 °C 45 s,
72 °C 45 s.
72 °C 7 min
[18]