Skip to main content

Table 1 Primer sequences used for PCR amplification and E. hepatopenaei (EHP) DIG probe preparation

From: Laboratory cohabitation challenge model for shrimp hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP)

Primer name Sequence (5′-3′) Amplicon (bp) Reference
SSU-PCR
1st PCR
   Tangprasittipap et al. 2013
 ENF779
 ENR779
CAGCAGGCGCGAAAATTGTCCA
A AGAGATATTGTATTGCGCTTGCT
779  
Nested PCR
 ENF176
 ENR176
CAACGCGGGAAAACTTACCA
ACCTGTTATTGCCTTCTCCCTCC
176  
EHP DIG probe    This paper
 ENF411 AGGTGGTGTTAAAAGCCATTGAG 235  
 ENR176 ACCTGTTATTGCCTTCTCCCTCC