Skip to main content

Advertisement

Table 1 Primer sequences used for PCR amplification and E. hepatopenaei (EHP) DIG probe preparation

From: Laboratory cohabitation challenge model for shrimp hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP)

Primer name Sequence (5′-3′) Amplicon (bp) Reference
SSU-PCR 1st PCR    Tangprasittipap et al. 2013
 ENF779  ENR779 CAGCAGGCGCGAAAATTGTCCA A AGAGATATTGTATTGCGCTTGCT 779  
Nested PCR
 ENF176  ENR176 CAACGCGGGAAAACTTACCA ACCTGTTATTGCCTTCTCCCTCC 176  
EHP DIG probe    This paper
 ENF411 AGGTGGTGTTAAAAGCCATTGAG 235  
 ENR176 ACCTGTTATTGCCTTCTCCCTCC