Skip to main content

Advertisement

Table 2 Primers and probe set used in RT-qPCR assays

From: New insight into dolphin morbillivirus phylogeny and epidemiology in the northeast Atlantic: opportunistic study in cetaceans stranded along the Portuguese and Galician coasts

  5′ Fluorophore 3′ Quencher Sequences (5′–3′) Amplicon size Annealing (°C)  
DMV-N-FP TGCCAGTACTCCAGGGAACATCCTTC 173 60 [26]
DMV-N-RP TTGGGTCGTCAGTGTTGTCGGACCGTT 173 60
DMV-N-probe Cy3 BHQ1 A + CA + CCAAA + AGGGA + CA 60