Skip to main content

Table 1 Primers for amplifying mouse cytokine cDNA by RT-PCR

From: NLRP3 inflammasome activation contributes to Listeria monocytogenes-induced animal pregnancy failure

Gene Forward primer sequence (5′ → 3′) Reverse primer sequence (5′ → 3′) Accession No. Size/bp
GAPDH GAAGGGTGGAGCCAAAAGGGTCAT CATTGGGGGTAGGAACACGGAAGG GU214026.1 360
IL-1β TACAGGCTCCGAGATGAACAACAA TGGGGAACTCTGCAGACTCAAACT BC011437.1 332
TNFα AGGGGCCACCACGCTCTTCTGT GCAAATCGGCTGACGGTGTGG BC117057.1 358
IL-6 AACCACGGCCTTCCCTACTTC TCTGGCTTTGTCTTTCTTGTTATC NM_031168.1 383
IL-8 ATGGCTGCTCAAGGCTGGTC AGGCTTTTCATGCTCAACACTAT NM_011339.2 386
MCP-1 AGGTCCCTGTCATGCTTCTGG TTACGGGTCAACTTCACATTCAAA BC145867.1 367