Skip to main content

Table 5 Primer used for sequencing of DNA from Duroc boars affected by polydipsia and polyuria and from negative controls

From: Diagnosis of diabetes insipidus observed in Swiss Duroc boars

Gene Chr Position exons Exon Forward primer Reverse primer Length
AVP 17 36950915-36951078 1 CATCTTGACCACACCACTGC TGTCCTAGTCCACCCGACA 576 bp
36952271-36952472 2 CCGAGCGAATCAGTAGCTTT TCGGTCACGCAGCTCTCT 546 bp
36952626-36952826 3 GCTGCCAGGAGGAGAACTAC ATCGCTTCCCCTACAGGATT 628 bp
AVPR2 X 142203295-142203330 1 CAGGAAGGGAAGCAGAGGA CTACGCTCCTCTCGGGACT 390 bp
142203810-142203859 2 CAAACCTGGTCAGGCTAAGG CTGCCAGCAGAACACACATC 496 bp
142204155-142205039 3a GCCTCTCCCCAGTAAGATGA GCTGAGAAGCAGCGAGAAG 747 bp
3b GTGGCTCTGTTCCAAGTGCT CGTAGATCCAGGGGTTGGTA 848 bp
142205173-142205695 4 GAAGGTGGGTGTGGCTGT ACTGCTCAAGGCCAGCTC 848 bp
AQP2 5 16095902-16095541 1 AACTCCACCTCCAACTCACG ATGTGTCTGGCTCCAGCATT 683 bp
16092242-16092078 2 CAGGAAGAAGGCATCCGTAG CCCCAGGAGGAGGACTGT 828 bp
16091774-16091694 3
16091033-16090821 4 TTACATGGATGCGCCTTTG CTCAGGGCAGGGGATCTT 497 bp