Skip to main content

Table 1 Primers used in this study. Name, sequence and reference of primers used and/or designed and synthesized for use in this study

From: Occurrence and identification of hemotropic mycoplasmas (Hemoplasmas) in free ranging and laboratory rats (Rattus norvegicus) from two Brazilian zoos

Primer Sequence (5’-3’) Reference
GAPDH-F CCTTCATTGACCTCAACTACAT Birkenheuer et al., 2003 [29].
GAPDH-R CCAAAGTTGTCATGGATGACC Birkenheuer et al., 2003 [29].
SYBR_For AGCAATRCCATGTGAACGATGAA Willi et al., 2009 [30].
SYBR_Rev1 TGGCACATAGTTTGCTGTCACTT Willi et al., 2009 [30].
SYBR_Rev2 GCTGGCACATAGTTAGCTGTCACT Willi et al., 2009 [30].
RodHem F1 GGGATTGAGATACGGCCCAT This study.
RodHem R1 AGGTCCCCGTCAATTCCTTT This study.
RodHem1300 Fw1 GCGAACGGGTGAGTAATGAA This study.
RodHem1300 Fw2 GCAAACGGGCGAGTAATACA This study.
RodHem1300 Rv TCATAGTTTGACGGGCGGT This study.