Skip to main content

Table 1 Primers used for amplification of B. melitensis omp25, omp28 and omp31 genes with vector cohesive overhangs (bold)

From: Serological diagnostic potential of recombinant outer membrane proteins (rOMPs) from Brucella melitensis in mouse model using indirect enzyme-linked immunosorbent assay

No Primer name Sequence (5′-3′) Length Expected product bp
1. B. melitensis omp25 F GACGACGACAAGATGCGCACTCTTAAGTCTCT 32 668
2. B. melitensis omp25 R GAGGAGAAGCCCGGTTAGAACTTGTAGCCGAT 32
3. B. melitensis omp28 F GACGACGACAAGATGAACACTCGTGCTAGCAATT 34 779
4. B. melitensis omp28 R GAGGAGAAGCCCGGTTACTTGATTTCAAAAACGA 34
5. B. melitensis omp31 F GACGACGACAAGATGAAATCCGTAATTTTGGCGT 34 749
6. B. melitensis omp31 R GAGGAGAAGCCCGGTTAGAACTTGTAGTTCAGAC 34