Skip to main content

Table 1 Primers used in QRT-PCR analysis

From: The early immune response to infection of chickens with Infectious Bronchitis Virus (IBV) in susceptible and resistant birds

Gene Forward primer Reverse primer Probe primer Opt. primer conc. Probe (μM) GenBank
28S GGCGAAGCCAGAGGAAACT GAC GACCGATTTGCACGTC AGGACCGCTACGGACCTCCACCA 0.6 5 FM165415
C1S GCGCAAAGGCTGGAAAATAC TCAAGAACAGAATTGGGAGTGACA TACTATGCTGAACCCATAACCTGTCTCCCG 0.6 5 NM_001030777
CCL13 CAGAGCCTGGCCCAGAGA TGTCCATTTTGATTCTTCTGGTATG CTGTGCCTGACAAGTGCTGCTTCAACTT 0.2 5 XM_415779
CCLi7 (ah221) CACAACCTGCTGCTTCTCCTATG TGTAGGCGGAGGCAATGAG TCAACGTCCCGTCCCACGCA 0.2 5 AY037860
CD38 GCTTGATGGGCTTTCATGGT CACATTCACTCCATTTTGGACAA ACCCCTCAGCTCCAGGAATCAACTATGAA 0.6 5 XM_420774
CLU TGAGTCAGAATCCCGTAACTTCAG GCAGTCCACAGCCAAGATCTC AGATCCGGCGCAACTCGGCC 0.2 5 NM_204900
COX11 TGGGATCTCCACCTACAACGTA CAGCCACTGTTCTTCAAAACAAA TGCCCTTCGAAGCAGGACAGTACTTCA 0.4 5 XM_001233972
DDT GGCCCCGAGCGGATT CATGACTGTTCTGTTCTTGCCAAT CATTCGCTTTTACCCGCTGGAGCC 0.8 5 NM_001030667
FK-506-BP51 CGGAGGATCAAGAGGAAAGGA CAGAACCCCTCCAGGTGAATT AAGGCTATTCCAACCCCAACGAAGGTG 0.1 5 NM_001005431
HSC20 GGAAATCATGGAAATCAATGAGAAA CACCTCTTTGGTCAGTTCTTCTTG CAGAGCCCGAGAACGACGAGATCC 0.8 5 XR_026662
IFNAR2 TGGTCACTGCATCTCTAAATAAACATT CTGCAATTGTGATGCCATAATAATC CATCCCATCAGCCTGGAAATGCATAACT 0.4 5 NM_204858
IGFBP5 GAAGAGCAGCCAGAGGATGGT GCTTGCACTGCTTCCTCTTGT CACCTCCCCAACTGCGACCGAAA 0.1 5 XM_422069
IRF-7 ACCCGGACCGCCGTAT GCCCAGGCCTTGAAGATCTC CATCCCTTGGAAGCACAACGCCA 0.6 5 NM_205372
MAFK GCGATGATGAACTCGTGTCAA TTCAGACGGATGACCTCCTCTT TCCGTACGGGAGCTGAACCAGCAC 0.4 5 NM_204756
MAP4K4 TGCTATTGAAATGGCTGAAGGA TCCGTGGGATGAGGAAGAGT TCCTCCCCTGTGTGACATGCACCC 0.2 5 NM_001031126
MMD2 TGCCACGCACGCATTCT GGTCATCGGAGAGGACGTAGAG TCCTGCCCAGCATCCTCGGC 0.4 5 XM_414787
MX1 TGGACTTCTGCAACGAATTGTC ATCCAGAAGAGTGCTGAAATGTTTG TTCACCTCCGCAATCCAGCAAGAGA 0.6 5 NM_204609
SRI TACTATCAGGGCGGGTATGGA AGCAAAATAACCATACAGAGGATCCT CAGCTCCAGGAGGCCCATCATTCC 0.1 5 NM_001080865
SUCLG2 AGCTTCCCGGCTGTTCAAT CATGGTCTGCCATCAGCTTTT AACCCCTAGACGATGGCTGAATCTGCA 0.1 5 NM_001006141
TLR3 ATCCATGGTGCAGGAAGTTTAAG GATGGAGTCTCGACTTTGCTCAATA TGCATCATGCTTTACAGC 1.0 5 JF273967.1
TNFAIP1 GTTGTGGGAAGCACTTTGGAA TCAACTCCTTGATCTCCTGTCTGT CCGAGATGACACAATTGCACTTCCAAAA 0.2 5 NM_001030726
TP-D53 TGGCCAAGCTAGAGGATGAAA TCAGGCTCATGCCAAGTTTTT ACTAGCAGCCAAAGAAAAGCACCTGATTGA 0.2 5 NM_204215