Skip to main content

Table 2 qPCR settings

From: Immune response of healthy horses to DNA constructs formulated with a cationic lipid transfection reagent

Cytokine Accession number Amplicon size (bp) Forward primer (5'–>3') Forward primer volume (μl) Reverse primer (5'–>3') Reverse primer volume (μl) Concentration of primers (pmol/μl)
IL12p35 NM_001082511.1 76 GCTGACAGCCATTGACAAGCT 1.5 TTCAAGGGAGGGCTTTTGTG 4.5 0.5
IL12p40 NM_001082516.1 76 TGCTGTTCACAAGCTCAAGTATGA 1.5 GGGTGGGTCTGGTTTGATGA 1.5 0.5
IL18 NM_001082512.1 124 TGCTGGACCAGTAGAAGACA 1.5 AGGTTCAAGCCTGCCAAAGT 1.5 5
IFNγ NM_001081949.1 417 GCTGTGTGCGATTTTGGGTT 1.5 CTCAGGTTAGCTTTGGGCGA 4.5 5
CXCL10 NM_001114940.1 153 GACTCTGAGTGGAACTCAAGGAAT 1.5 GTGGCAATGATCTCAACACG 4.5 5