Skip to main content

Table 2 The gene name, GeneBank accession number, sequence and product size of the primers used for the qRT-PCR

From: Lipopolysaccharide derived from the rumen down-regulates stearoyl-CoA desaturase 1 expression and alters fatty acid composition in the liver of dairy cows fed a high-concentrate diet

Gene Accession # 1 Forward Primer (5’-3’) Reverse Primer (5’-3’) Product Size
GAPDH§ NM_001034034 GGGTCATCATCTCTGCACCT GGTCATAAGTCCCTCCACGA 176
ACC-α§ NM_174224 AGCTGAATTTTCGCAGCAAT GGTTTTCTCCCCAGGAAAAG 117
FASN§ AF285607 GCATCGCTGGCTACTCCTAC GTGTAGGCCATCACGAAGGT 136
LPL§ NM_001075120 GGGTTTTGAGCAAGGGTACA GCCACAATGACCTTTCCAGT 193
FABP1& FJ415874.1 GTTCATCATCACCGCTGGCT CCACTGCCTTGATCTTCTCCC 101
PLIN2& NM_173980.2 TTTATGGCCTCATGCTTTTGC CTCAGAGCAGACCCCAATTCA 100
ACOX1& NM_001035289.3 ACCCAGACTTCCAGCATGAGA TTCCTCATCTTCTGCACCATGA 100
CPT1α& FJ415874.1 TCGCGATGGACTTGCTGTATA CGGTCCAGTTTGCGTCTGTA 100
SCD§ NM_173959.4 TTATTCCGTTATGCCCTTGG GGTAGTTGTGGAAGCCCTCA 151
DGAT1& FJ415874.1 CCACTGGGACCTGAGGTGTC GCATCACCACACACCAATTCA 101
DGAT2& FJ415874.1 CATGTACACATTCTGCACCGATT TGACCTCCTGCCACCTTTCT 100
SREBF1c FJ415874.1 CACTCGTCTTCCTCTGTCTC GAGTGACTGGTTCTCCATAG 243
SREBF2& NM_001205600.1 AGAGCAAACTCCTGAAGGGC GGAGGCGACATCAGAAGGAC 103
SCAP NM_001101889.1 CATCAAGCTCTACTCCATCC CAATGGCAGCGTTGTCCAGCA 206
LXRα& NM_001014861.1 CCCCATGACCGACTGATGTT TGTCCTTCATCTGGCTCCACC 241
PPARα& FJ415874.1 CATAACGCGATTCGTTTTGGA CGCGGTTTCGGAATCTTCT 102
  1. §published in [19,20]. &published in [21].
  2. 1Entrez Gene, National Center for Biotechnology Information (NCBI).