Skip to main content

Table 2 The primer sequences, amplicon length, melting temperature and no. of GenBank access of studied genes

From: Expression patterns of β-defensin and cathelicidin genes in parenchyma of bovine mammary gland infected with coagulase-positive or coagulase-negative Staphylococci

Gene name Gene symbol Primersequence 5′-3′ Length of amplicon (bp) Melting temp. (°C) GenBank No access
Cathelicidin 4 = indolicidin CATHL4* ACCCATCCAATGACCAGTTTGACC TTCACTGTCCAGAAGCCCGAATCT 177 60 X67340.1
Cathelicidin 5 = bovine myeloid antimicrobial peptide 28 CATHL5* = BMAP28 TCGGGAGTAACTTCGACATCACCT GGCCCACAATTCACCCAATTCTGA 141 60 X97609.1
Cathelicidin 6 = bovine myeloid antimicrobial peptide 27 CATHL6* = BMAP27 ATGGGCTGGTGAAGCAATGTGTAG TGGAGTAGCGGAATGACTGGAGAA 163 60 X97608.1
β-defensin1 = enteric β-defensin DEFB1 = EBD ATCCTCTAAGCTGCCGTCT AGCATTTTACTGAGGGCGT 102 58 NM_175703.3
β-defensin4 = bovine neutrophil β-defensin4 DEFB4 = BNBD4 CGTTCTTGTGCCGTGTAG AAATTTTAGACGGTGTGTTG 149 58 NM_174775
β-defensin5 = bovine neutrophil β-defensin5 DEFB5 = BNBD5 TCCTCGTGCTCCTCTTCCTA CATATTCCAACGGCAGCTTT 143 58 NM_001130761
β-defensin10 = bovine neutrophil β-defensin10 DEFB10 = BNBD10 AGTTATCTAAGCTGCTGGG CGCTCTGTCAAAGGGTC 173 58 NM_001115084
Tracheal antimicrobial peptide TAP** TCCTGGTCCTGTCTGCTTC CTACAGCATTTTACTGCCCG 151 58 NM_174776
Tracheal antimicrobial peptide TAP*** GCGCTCCTCTTCCTGGTCCTG GCACGTTCTGACTGGGCATTGA 216 57 NM_174776
Lingual antimicrobial peptide LAP GAAATTCTCAAAGCTGCCGTA TCCTCCTGCAGCATTTTACTT 194 58 NM_203435
  1. *primer sequences according to Tomasinsiget al. (2010) [33].
  2. **primer sequences according to Whelehan et al. (2011) [23].
  3. ***primer sequences according to Alva-Murillo et al. (2012) [29].