Skip to main content

Table 6 Characteristics of the primers used in RT-PCR analysis and PCR product sizes

From: Studies on the health impact of Agrimonia procerain piglets

Gene Forward primer (from 5' to 3') Product size (bp) NCBI GenBank number
Reverse primer (from 5'to 3')
β-actin GACATCCGCAAGGACCTCTA 205 DQ_845171.1
ACATCTGCTGGAAGGTGGAC
SDHA1 CTAGCCCCCGTCGCAAAGG 380 DQ_402993
AGTTTGCCCCCAGGCGGTTG
RPP0 CAACCCTGAAGTGCTTGACA 204 NM_001098598.1
GCCTTGACCTTTTCAGCAAG
TNFα AACCCTCTGGCCCAAGGA 57 NM_214022.1
GGCGACGGGCTTATCTGA
IL-1β AAAGGGGACTTGAAGAGAG 286 NM_001005149.1
CTGCTTGAGAGGTGCTGATGT
IL-10 GCATCCACTTCCCAACCA 446 NM_214041.1
CTTCCTCATCTTCATCGTCAT
  1. 1SDHA, succinate dehydrogenase complex subunit A; RPP0, ribosomal phosphoprotein large PO subunit; TNF, tumor necrosis factor; IL, interleukin.