Skip to main content

Table 4 The sequences of miRNAs and accession numbers of the primers used in the study (Exiqon, Denmark)

From: Plasma miRNAs as potential biomarkers of chronic degenerative valvular disease in Dachshunds

Primer Target sequence Accession
hsa-miR-126-5p LNA™ PCR primer set, UniRT CAUUAUUACUUUUGGUACGCG MIMAT0000444
hsa-miR-208a LNA™ PCR primer set, UniRT AUAAGACGAGCAAAAAGCUUGU MIMAT0000241
hsa-miR-208b LNA™ PCR primer set, UniRT AUAAGACGAACAAAAGGUUUGU MIMAT0004960
hsa-miR-423-5p LNA™ PCR primer set, UniRT UGAGGGGCAGAGAGCGAGACUUU MIMAT0004748
hsa-miR-133b LNA™ PCR primer set, UniRT UUUGGUCCCCUUCAACCAGCUA MIMAT0000770
hsa-miR-125b-5p LNA™ PCR primer set, UniRT UCCCUGAGACCCUAACUUGUGA MIMAT0000423
hsa-miR-30b-5p LNA™ PCR primer set, UniRT UGUAAACAUCCUACACUCAGCU MIMAT0000420
hsa-miR-21-5p LNA™ PCR primer set, UniRT UUCCCUUUGUCAUCCUUUGCCU MIMAT0000668
hsa-miR-16-5p LNA™ PCR primer set, UniRT UAGCAGCACGUAAAUAUUGGCG MIMAT0000069
hsa-miR-29b-3p LNA™ PCR primer set, UniRT UAGCACCAUUUGAAAUCAGUGUU MIMAT0000100