Skip to main content

Table 7 Primers used for amplifying TLR2 , 4 and 9 for sequencing

From: Assessment of Toll-like receptor 2, 4 and 9 SNP genotypes in canine sino-nasal aspergillosis

Gene Accession number   Product length Forward primer (5′-3′) Reverse primer (5′-3′)
TLR2 NC_006597.3   2538 AATAAACTGTCAAAACAATCACTCA AAGCAAGTCTGCAAAGGACA
TLR4 NC_006593.3 exon 1 359 ACAAAAGCCCAGAACGCTAA TGCACAGAGAGCAGTTTTTCA
   exon 2 397 GAGAGAGGGCAGTTGAGGTG AGATGAGGCAATGGGATCTG
   exon 3 3111 CTGAATCTGTGGGGCTTCTT GAGACATGAAAAATGAGAACTGGA
TLR9 NC_006602.3 exon 3 3390 GGAACCCTGTTGGGAGACC TTTGGGAAGGAAAGCCTGAC