Skip to main content

Table 1 Primers used for RT-qPCR of hepatic biomarkers

From: An epidemiological investigation into the association between biomarkers and growth performance in nursery pigs

Gene symbol Gene name Accession numbera Primers (5′ – 3′) Tm(°C) Amplicon length (bp) R2 Primer efficiency (%)
IL1B Interleukin-1β NM_214055 F: GGCCGCCAAGATATAACTGAb 59 70 0.991 100
R: GGACCTCTGGGTATGGCTTTCb
IL6 Interleukin-6 NM_214399 F: CCCTGAGGCAAAAGGGAAAGA 60 212 0.998 95.2
R: CGTGGACGGCATCAATCTCA
IL10 Interleukin-10 L20001 F: CAGATGGGCGACTTGTTGb 57 219 0.993 91.7
R: ACAGGGCAGAAATTGATGACb
IL18 Interleukin-18 NM_213997 F: GCTGCTGAACCGGAAGACAA 60 192 0.996 95.3
R: AAACACGGCTTGATGTCCCT
IFNA Interferon-α AB257591 F: GACCTGCCTCAGATCCACAG 60 158 0.986 82.3
R: ATGGCTTGAGCCTTCTGGAC
IFNG Interferon-γ X53085 F: CAAAGCCATCAGTGAACTCATGAb 60 100 0.985 98.7
R: TCTCTGGCCTTGGAACATAGTCTb
TNFA Tumor necrosis factor-α NM_214022 F: CCTCTTCTCCTTCCTCCTGb 57 194 0.997 100
R: CCTCGGCTTTGACATTGGb
CRP C-reactive protein NM_213844 F: TGCCCAGACAGACATGATCG 60 131 0.999 100
R: GGTCGGTATAGACACGCAGG
HP Haptoglobin NM_214000 F: TGAATGTGAAGCAGTGTGCG 59 133 0.996 96
R: CGAGGTGAGGTTATGGTGGG
SAA Serum amyloid A EF362780 F: TGATCAGCGATGCCAGAGAG 60 85 0.998 87.8
R: CTTGAGTCCTCCACTCCGTG
IGF1 Insulin-like growth factor-1 JX827417 F: TCTTCTACTTGGCCCTGTGCTT 61 81 0.998 97.7
R: CCAGCTCAGCCCCACAGA
IGFBP3 Insulin-like growth factor binding protein-3 NM_001005156 F: GGCATCCACATCCCCAACT 60 80 0.990 97.3
R: CCCCGCTTCCTGCCTTT
GHR Growth hormone receptor JF276446 F: CTCCACAGGGCCTCGTACTC 60 80 0.999 89.2
R: GCTCACATAGCCACACGATGA
GAPDH Glyceraldehyde 3-phosphate dehydrogenase NM_001206359 F: ACACACCGAGCATCTCCTGACT 61 80 0.998 100
R: CGAGGCAGGTCTCCCTAAGC
  1. aAccessed via GenBank.
  2. bDesigned by Collado-Romero et al. [17].