Skip to main content

Table 1 Primer sequences for real-time PCR

From: Inhibition of heat-induced apoptosis in rat small intestine and IEC-6 cells through the AKT signaling pathway

Description Accession number Primer sequence Product (bp)
β-actin NM_031144 Forward: TTGTCCCTGTATGC CTCTGG 218
Reverse: ATGTCACGCACGATTTCCC
HSP27 NM_031970.3 Forward: GGCAAGCACGAAGAAAGG 269
Reverse: GATGGGTAGCAAGCTGAAGG
HSP70 NM_031971.2 Forward: CGTGCCCGCCTACTTCA 280
Reverse: CACCAGCCGGTTGTCGA  
HSP90 NM_175761.2 Forward: GTCCCGGTGCGGTTAGTCACG 70
Reverse: TTGGGTCTGGGTTTCCTCAGGC
Bcl-2 NM_001191.2 Forward: CTGGGAGGAGAAGATGC 126
Reverse: ACCTTTGTTCCACGACCCATAG
Bax NM_017059.2 Forward: CAGGACGCATCCACCAAGAA 114
Reverse: GGGTCCCGAAGTAGGAAAGG