Skip to main content

Table 2 Primers used for real-time qPCR

From: Five markers useful for the distinction of canine mammary malignancy

Gene symbol Forward primer Reverse primer Optimum annealing temp. (°C) Optimum annealing time (sec)
hprt AGCTTGCTGGTGAAAAGGAC TTATAGTCAAGGGCATATCC 59 6
rps19 CCTTCCTCAAAAAGTCTGGG GTTCTCATCGTAGGGAGCAAG 61 10
serhl TTGGTGCTAGACACGCTGAG CTGCAGAAAGGCACTGATGA 61 5
zfp37 GCGGAATGGGAACAACTAGA ATGTCTGGTTTGGGAGCTTG 61 8
mipep CCCTGAGAAAGGCAGACTTG AGCCACTCTGCACAAGGAAT 60 5
relaxin AAGTTGTGCCATCCTCCATC CCAGACCGTGTTGCTATCCT 60 7
magi3 AGGTGACATTGGGAAAGACG CAGCCCCATGTTGTACTCCT 60 8
  1. Primers sequences used in this study and their annealing optimal temperature and time. The mRNA sequences of key genes were obtained from NCBI database. Primers were designed using PRIMER3 software (free on-line access) and checked using Oligo Calculator (free on-line access) and Primer-Blast (NCBI database). hprt and rps19 genes were used as non-regulated reference genes for normalization of target gene expression [6, 7].