Skip to main content

Table 1 Nucleotide sequences of the CBPP LAMP primers used

From: Isothermal loop-mediated amplification (lamp) for diagnosis of contagious bovine pleuro-pneumonia

Msc3.1-F3 ACTACTTGTTGTTGTAGTGTTTG
Msc3.1-B3 ATGGTGGTTTATCAAATGATGA
Msc3.1-FIP TCAAAGAGATAATTCTACTTCAGCTAAGGATCCTGAAGAACCAGAA
Msc3.1-BIP TCTAGCAGAATTTTTTGCACTTAACAAAGTTGATAACGCAATAGAGC