Skip to main content

Table 2 List of primers used in quantitative reverse-transcription PCR (RT-PCR)

From: Molecular cloning and expression analysis of peptidase genes in the fish-pathogenic scuticociliate Miamiensis avidus

Target clone/gene Primers Sequences (5- 3) Product size (bp)
MaPro 1 Forward TGCTTCCACTTCAGTTTTATCAGTCG 266
  Reverse GGTTAAGTTCAACTGTGGGGATTTCTAA  
MaPro 2 Forward TCTTGAGAGCTTCTGCTGCCAC 271
  Reverse TCTTGGATGTTTAATTCGGTGCTGT  
MaPro 3 Forward AATCCAACGAAGACATCAGAATCTTCT 246
  Reverse CAGGGACTTATCTGGAAGGTCTGGA  
MaPro 4 Forward TAGCTTCAATTGCTTCTGGTAGTCTTG 277
  Reverse ATCCATGTTTATTCCACATAGTCCATTAC  
MaPro 5 Forward ATTTCAAGCGATTGGAAGCTAAGAATC 308
  Reverse AATAATCCCAAATAGAATATTACCCATCTTC  
MaPro 6 Forward ACTTGGACTGCTGGATACAACAAAC 310
  Reverse CGGTGGAGATTCTGGTTTGAAC  
MaPro 7 Forward CGGTGGAGATTCTGGTTTGAAC 212
  Reverse TTCGGCATCAACAGAATGGTAGATAC  
MaPro 8 Forward ACGTTTTATTAGAAAGCCAAGGTAACC 260
  Reverse GGTATTTTCGTCGGTGTATTTGTAGCT  
MaPro 9 Forward GGGAAAAGGAAACTCTGCATTCG 348
  Reverse CATCCATTTTCAGCAGTGTACAGTTCTAT  
MaPro 10 Forward CAGATAATGGCTCTACTAATATTGCACTC 243
  Reverse AGGGATCTTCACTTCCATTTGTGAATAC  
MaPro 11 Forward ATTTGGCTCAATGGAGGACCTG 217
  Reverse CAGCGGTATTATCATCAGTGTAAGAGT  
MaPro 12 Forward CCACCTACAAACCCCAAGGAGAC 268
  Reverse GCGAAAGAGTTGTCTTCCCAGACT  
MaPro 13 Forward CAGCTCTTTTAACAGAAGGAGCTACAC 352
  Reverse TTTCTGAACTTCGGTATCCACCATA  
MaPro 14 Forward AGGGTATCTTCGAACAGCTCTTCG 319
  Reverse CATTGGGACAAGAGACTGAACAGTC  
MaPro 15 Forward AGCCTTGGAATGGAAATACTTTCGCTG 319
  Reverse CCAACACAGTATCCGTTAGAGCTACAG  
MaPro 16 Forward ACTCACGGATAGAACAATGCTCTTGC 314
  Reverse TTAAAGTGCTTGCGAGCCACTTCC  
MaPro 17 Forward TTGCAAGTTTCCTCTGGATTTGAATC 327
  Reverse TCCGTATATAAGTTCAATTGTGGCATC  
β-tubulin Forward GTATGATCATTGATAACGAAGCCCTCTACG 323
  Reverse TCTGGGATCGGCGGCGCACATCATG