Skip to main content

Table 5 Primers used for amplification of SCCmec type and enterotoxin gene

From: Genetically divergent methicillin-resistant Staphylococcus aureus and sec-dependent mastitis of dairy goats in Taiwan

Locus Primer Oligonucleotide sequence (5'-3') Amplicon size (bp) SCCmectypee Reference
SCCmec      
A CIF2 F2 a TTCGAGTTGCTGATGAAGAAGG 495 I [17]
  CIF2 R2 a ATTTACCACAAGGACTACCAGC    
B KDP F1 b AATCATCTGCCATTGGTGATGC 284 II [18]
  KDP R1 b CGAATGAAGTGAAAGAAAGTGG    
C MECI P2 b ATCAAGACTTGCATTCAGGC 209 II, III  
  MECI P3 b GCGGTTTCAATTCACTTGTC    
D DCS F2a CATCCTATGATAGCTTGGTC 342 I, II, IV [17]
  DCS R1a CTAAATCATAGCCATGACCG    
E RIF4 F3c GTGATTGTTCGAGATATGTGG 243 III [18]
  RIF4 R9c CGCTTTATCTGTATCTATCGC    
F RIF5 F10c TTCTTAAGTACACGCTGAATCG 414 III  
  RIF5 R13c GTCACAGTAATTCCATCAATGC    
G IS431 P4b CAGGTCTCTTCAGATCTACG 381   
  pUB110 R1b GAGCCATAAACACCAATAGCC    
H IS431 P4c CAGGTCTCTTCAGATCTACG 303   
  pT181 R1c GAAGAATGGGGAAAGCTTCAC    
mecA MECA P4d TCCAGATTACAACTTCACCAGG 162 Internal control [16]
  MECA P7d CCACTTCATATCTTGTAACG    
Staphylococcal enterotoxin (SEs)
sea ESA 1 ACGATCAATTTTTACAGC 544   [68]
  ESA 2 TGCATGTTTTCAGAGTTAATC    
seb ESB 1 GAATGATATTAATTCGCATC 416   [69]
  ESB 2 TCTTTGTCGTAAGATAAACTTC    
sec ESC 1 GACATAAAAGCTAGGAATTT 257   [70]
  ESC 2 AAATCGGATTAACATTATCCA    
sed ESD 1 TTACTAGTTTGGTAATATCTCCTT 334   [71]
  ESD 2 CCACCATAACAATTAATGC    
see ESE 1 ATAGATAAAGTTAAAACAAGCAA 170   [72]
  ESE 2 TAACTTACCGTGGACCC    
seg ESG 1 ACGTCTCCACCTGTTGAAGG 400   [73]
  ESG 2 TGAGCCAGTGTCTTGCTTTG    
seh ESH 1 TCACATCATATGCGAAAGCAG 357   [74]
  ESH 2 TAGCACCAATCACCCTTTCC    
sei ESI 1 TGGAACAGGACAAGCTGAAA 467   [73]
  ESI 2 TAAAGTGGCCCCTCCATACA    
sej ESJ 1 CAGCGATAGCAAAAATGAAACA 426   [75]
  ESJ 2 TCTAGCGGAACAACAGTTCTGA    
Sec f setC-F
setC-R
AGATTTAGCAAAGAAGTACAAAGATG
AAGGTGGACTTCTATCTTCACACTT
490   [76]
  1. aRelative to accession no. AB033763, SCCmec type I
  2. bRelative to accession no. D86934, SCCmec type II
  3. cRelative to accession no. AB037671, SCCmec type III
  4. dRelative to accession no. Y00688, mecA gene.
  5. eLoci G and H were included to distinguish variants IA from I and IIIA from III, respectively
  6. fPrimer pair used for PCR-RFLP