Skip to main content

Table 1 Primers used for real-time qPCR

From: Global gene expression profiles of canine macrophages and canine mammary cancer cells grown as a co-culture in vitro

Gene symbol Forward primer Reverse primer Optimum annealing temp. (°C) Optimum annealing time (sec)
CCL2 CTCCAGTCACCTGCTGCTAT CACAGCTTCTTTGGGACACT 60 4
CCL3 CCAGGTCTTCTCACCATTTG AGATAATACCGGGCTTGGAG 60 5
CD163 ATGTCCAGTGTCCAAAAGGA CATGTGATCCAGGTCTCCTC 61 6
CSF1R TGCAGTTTGGGAAGACTCTC TGTGGACTTCAGCATCTTCA 60 4
HIF1 GATTGCAGCTCCATCTCCTA TCCTTTTCCTGCTCTGTTTG 58 5
IL18 GATATGCCCGATTCTGACTG GCCTGGAACACTTCTCTGAA 60 9
MMP9 CGACTACGACCAGGACAAAC AAGCCCCACTTCTTGTCTCT 61 8
VEGF-C CAGCAACACTACCACAGTGC CTCCAGAATTTGAGGCAAAA 61 5
Wnt7b GCGGAGGGCTGTGTATAAGA GTCCCCTACTTTGCGGAACT 59 5
HPRT AGCTTGCTGGTGAAAAGGAC TTATAGTCAAGGGCATATCC 59 6
RPS19 CCTTCCTCAAAAAGTCTGGG GTTCTCATCGTAGGGAGCAAG 61 10
  1. Primers sequences used in this study and their annealing optimal temperature and time. The mRNA sequences of key genes were obtained from NCBI database. Primers were designed using PRIMER3 software (free on-line access) and checked using Oligo Calculator (free on-line access) and Primer-Blast (NCBI database). Primers sequences are listed in Table 1. HPRT and RPS19 genes were used as non-regulated reference genes for normalization of target gene expression [3, 9]