Skip to main content

Table 1 List of primers used for RT PCR quantification of gene expression

From: SPI-1 encoded genes of Salmonella Typhimurium influence differential polarization of porcine alveolar macrophages in vitro

  Sequence 5'-3' Reference
CD163-For CTTGGGGCAGCGTTGGCAGGAATAG this study
CD163-Rev ATGCAGGGCTGATGTCCCCTCTGTC this study
HPRT-For GAGCTACTGTAATGACCAGTCAACG [21]
HPRT-Rev CCAGTGTCAATTATATCTTCAACAATCAA [21]
IL10-For TGAAGAGTGCCTTTAGCAAGCTC this study
IL10-Rev CTCATCTTCATCGTCATGTAGGC this study
IL1β-For GGGACTTGAAGAGAGAAGTGG [9]
IL1β-Rev CTTTCCCTTGATCCCTAAGGT [9]
IL4R-For TTCAACACTGAAAACCACACCAC this study
IL4R-Rev GTGTCCACAATGACAATGCTCTC this study
IL8-For TTCTGCAGCTCTCTGTGAGGC [22]
IL8-Rev GGTGGAAAGGTGTGGAATGC [22]
MannR-For GACCAAAAATTGTTGATGCTGA this study
MannR-Rev GCACCCGTTAGAATCAGGAG this study
MMP12-For AGAGGAGGCACATCATGGAC this study
MMP12-Rev CTTCTGGTGACACGATGGAA this study
MMP9-For CCTTGAACACACACGACATCTTC this study
MMP9-Rev CCACATAGTCCACCTGATTCACC this study
NFκBIα-For ACGAGCAGATGGTGAAGGAG this study
NFκBIα-Rev TCATGGATGATGGCCAAGT this study
TFRC-For AATTCAGAGTTGACATAAGGGAGATG this study
TFRC-Rev AGACGTAGCACGGAAGAAGTCTC this study
TIMP1-For CAGGAGTTTCTCATAGCTGGACAAC this study
TIMP1-Rev GTTCCAGGGAGCCACAAAACT this study
TNFβ-For CCCCCAGAAGGAAGAGTTTC [21]
TNFβ-Rev CGGGCTTATCTGAGGTTTGA [9]
Arginase1-For CCAGTCCATGGAGGTCTGTC this study
Arginase1-Rev GTGTCTTCCCCAGAGATGGA this study