Skip to main content

Table 1 Primers and probes used in this study

From: Investigation of an outbreak of mycobacteriosis in pigs

Target Size of amplified sequence (bp) Primers and probes GenBank accession no.
IS1245 82 Primer 41: ggtgagcggatcactcaag*
Primer 116: ggagaagccccgatgaac
Probe 3: caagccttgatcgacgcgga
L33879
IS6110 101 Primer 149: gccaactacggtgtttacgg
Primer 150: agtttggtcatcagccgttc
Probe 6: gggcatcgaggtggccagat
X17348.1
Porcine β-globin
gene
119 Primer 120: gggggttgcaatttattcct
Primer 121: tgaatcacggtcctgtgaaa
Probe 4: cgcagattcccaaaccttcgc
X86791
  1. *[18]