Skip to main content

Table 2 Virulence genes and PCR primers used to test screen Salmonella isolates.

From: Characterisation of Salmonella entericaserotype Typhimurium isolates from wild birds in northern England from 2005 – 2006

Virulence gene Pathogenicity island Gene function Broad action Primer sequence (5' to 3')
prgH SPI-1 Type III secretion system apparatus Invasion of macrophages F: GCCCGAGCAGCCTGAGAAGTTAGAAA
R: TGAAATGAGCGCCCCTTGAGCCAGTC
sopB SPI-1 Type III secreted effector protein Invasion of macrophages F: CGGACCGCCCAGCAACAAAACAAGAAGAAG
R: TAGTGATGCCCGTTATGCGTCAGTGTATT
sopE SPI-1 Type III secreted effector protein Invasion of macrophages F: TCAGTTGGAATTGCTGTGGA
R: TCCAAAAACAGGAAACCACAC
invA SPI-1 Type III secretion system apparatus Invasion of macrophages F: CTGGCGGTGGGTTTTGTTGTCTTCTCTATT
R: AGTTTCTCCCCCTCTTCATGCGTTACCC
sitC SPI-1 Iron transport Invasion of macrophages/iron acquisition F: CAGTATATGCTCAACGCGATGTGGGTCTCC
R: CGGGGCGAAAATAAAGGCTGTGATGAAC
spiC SPI-2 Type III secretion system Survival in macrophages F: CCTGGATAATGACTATTGAT
R: AGTTTATGGTGATTGCGTAT
sifA SPI-2 Type III secreted effector protein Survival in macrophages F: TTTGCCGAACGCGCCCCCACACG
R: GTTGCCTTTTCTTGCGCTTTCCACCCATCT
misL SPI-3 Involved in intramacrophage survival Survival in macrophages F: GTCGGCGAATGCCGCGAATA
R: GCGCTGTTAACGCTAATAGT
orfL SPI-4 Adhesin/autotransporter Survival in macrophages/colonisation F: GGAGTATCGATAAAGATGTT
R: GCGCGTAACGTCAGAATCAA
pipD SPI-5 Type III secreted effector-associated with SPI-1 system Enteritis F: CGGCGATTCATGACTTTGAT
R: CGTTATCATTCGGATCGTAA
iroN NA Siderophore (iron acquisition) Associated with iron usage F: ACTGGCACGGCTCGCTGTCGCTCTAT
R: CGCTTTACCGCCGTTCTGCCACTGC
pefA NA Fimbriae Movement F: GCGCCGCTCAGCCGAACCAG
R: CAGCAGAAGCCCAGGAAACAGTG