Skip to main content

Table 3 Primers for amplification of the microsatellites at the exact position of the candidate gene loci

From: A study of candidate genes for day blindness in the standard wire haired dachshund

Microsatellite Forward primer (5'-3') Reverse primer (5'-3') Size of PCR-product (bp) Nucleotide repeat Location (bp) Accession number
CNGB3-FH2772 CCCAAAGCACATCCTAATTC GGAGTCTGCTTCTCCCTTTC 168 di Chr29:35405042-35405217 UniSTS 263646
CNGB3-C29.002 TATTAAATCCCAGTCACCACCC AGGTCCCAGACCGAGTCC 208 di Chr29:36423257-36423471 UniSTS 262830
CNGA3-GT19 CCTCCCACTCTCCCCTCTAC CCAGGGGAGCTTTTACAACA 337 di Chr10:47307640-47307977 BV729091
CNGA3-GT20 GCAAGCAGTCCCGATTTTTA TCAGCTTTGGTCATGCACTC 304 di Chr10:47283009-47283313 BV729076
GNAT2-GAAA16 CCCATGCTTGGTTTAATGCT GACTGTCCTGCCTTCCATGT 350 tetra Chr6:45194834-45195184 BV729077
GNAT2-CTT22 CAGCTGGATTCTTCCCATGA GCCCAAATTGCAAATCCTTA 273 tri Chr6:45461591-45461864 BV729078
ABCA4-FH2370 CCTGAAAAATAGCTAGATGATGG GTCTTTACCTGCCTATATAGCTGC 380 tetra Chr6:58367514-58367919 UniSTS 263571
ABCA4-TTTC16m GGAATCAGTGGACTCATCCAA GGGGATTGGACAGTGGTAGA 238 tetra Chr6:58046419-58046656 BV729079
RDH5-TAGA10 GAAGATGACGATGATGATGAAGA GCTGAAGGTAGACGCTGGAC 286 tetra Chr10:3068645-3068931 BV729080
RDH5-GAAA16 CCCTGCTGTGAGGAGTCAGT AGCCAGATGCAGGACTTGAT 209 tetra Chr10:3002063-3002276 BV729081
CORD8-FMO5-GAAA12 CCACAAGTTGGGGTTTCAAG CCCCTCCTCTCTCTCTTTCC 204 tetra Chr9:60070458-60070662 BV729082
CORD8-FMO5-TTTA10 CCCAGGTGTCCCTATTTTCC GCTCACTGGGGAGTCTGCT 175 tetra Chr9:60654305-60654480 BV729083
CORD9-RP1-ATm22 CACTGGATGCACACAGATCC GGTCCTTGAGAAGGAAGCTG 296 di Chr29:9128657-9128953 BV729084
CORD9-RP1-TTTC21m TCCAGTAGGCGTCCTCTGAC AGTCAATGGAGCCTGCAACT 410 tetra Chr29:9011174-9011583 BV729085
RPGRIP1-GAAA26 TGTTACCTGTTCCAAAGTTGTTTT AGTTACAGCCATGGGAATGC 475 tetra Chr15:21287275-21287750 BV729086
GUCY2D-TTCC15 ACAATGGGCACATCTGTTGA TTCTCCCTCTGCCTGTGTCT 405 tetra Chr5:35459311-35459716 BV729089
GUCY2D-GAAA17 CCCCTCTTCTCCACTCTCCT TCATATTCTTGCCCCAGTCC 444 tetra Chr5:35514793-35515246 BV729090
CRX-GAAA15m TGGTCTCACATTCCCACTGA AGAAGTGGCAGAGCACAGGT 438 tetra Chr1:111096908-111097346 BV729087
CRX-GT21 ACCAGAACCAAAGGCAGATG TCAGGGTTGGAGTTTTGAGC 427 di Chr1:111076912-111077339 BV729088