Skip to main content

Table 5 Oligonucleotide primer sequences used for qRT-PCR and recombinant protein expression

From: Identification of immune genes and proteins involved in the response of bovine mammary tissue to Staphylococcus aureus infection

Gene Accession number Forward (5'→3') Reverse (5'→3') Size (bp) Ref.
RPLP0 BT021080 CAACCCTGAAGTGCTTGACAT AGGCAGATGGATCAGCCA 220 [12]
IL-1β M35589 AAATGAACCGAGAAGTGGTGTT TTCCATATTCCTCTTGGGGTAGA 185 [12]
IL-6 X57317 CTGGGTTCAATCAGGCGAT CAGCAGGTCAGTGTTTGTGG 206 [12]
IL-8 AF232704 CTGTGTGAAGCTGCAGTTCT TAAGCAGACCTCGTTTCCAT 180 [12]
TNFα NM_173966 CTGGTTCAGACACTCAGGTCCT GAGGTAAAGCCCGTCAGCA 183 [12]
CD14 D84509 GGTGCTACCCGATGTGTCTG AAGGGATTTCCGTCCAGAGT 191 [12]
CSN1S1 M38641 CCTGTCTTGTGGCTGTTGCTCTTG CATCTTCCTTTTGAATGTGCTTCTGCT 282 pc*
CSN2 M16645 TCTGCCTCTGCTCCAGTCTT AGGAGGGGGCATTCACTTT 251 pc*
S100A12 NM_174651 CATTTCGACACCCTCAACAA CTGTTTTCAGCACCCTGGAC 184  
rS100A12 NM_174651 CCGGATCCACTAAGCTGGAAGATCACCTGGAGG CCAAGCTTTACTCTTTGTGGATATCTATGTGGGCTG -  
PTX3 NM_001076259 TATGCCATGGTGCTTTCAGA CCAATGAACAATGGACAACAA 182  
rPTX3 NM_001076259 ATGGATCCGAGAACTCAGATGATTATGAGCTCATGTA AGAAGCTTTTAATAAACATACTGTGCTCCTCGTG -  
rtnPTX3 NM_001076259 GTGGATCCGGAGAACTCAGATGATTATGAGCTCATGTA AGAAGCTTTTAATAAACATACTGTGCTCCTCGTG -  
  1. * Personal communication (Karen Matthews)