Skip to main content

Table 1 Sequences of primers and TaqMan probes

From: Porcine congenital splayleg is characterised by muscle fibre atrophy associated with relative rise in MAFbx and fall in P311expression

Gene Primer Sequence 5' → 3'
Porcine MAFbx S AAGCGCTTCCTGGATGAGAA
  A GGCCGCAACATCATAGTTCA
  P AGCGACCTCAGCAGTTACTGCAACAAGG
Porcine P311 S GAG GGA AGG CCT AAG GG
  A CGG TCT CGC CAT CCT TCT T
  P ACT TCC CAT CCC AAA GGA AGT GAA CCG
Murine P311 S CAGCCAAGAACCGTTTGCAT
  A CACTTCCTTAGGCACGGGAA
  P TTCCCTTAATAAGACCTCCCTCCATTTCCTTG
Murine MYHslow S GCC TGG GCT TAC CTC TCT ATC AC
  A CTT CTC AGA CTT CCG CAG GAA
  P CGT TTG AGA ATC CAA GGC TCA
Murine MYH2a S CAG CTG CAC CTT CTC GTT TG
  A CCC GAA AAC GGC CAT CT
  P TGA GTT CAG CAG TCA TGA G
Murine MYH2x S GGA CCC ACG GTC GAA GTT G
  A GGC TGC GGG CTA TTG GTT
  P CTA AAG GCA GGC TCT CTC ACT GGG CTG
Murine MYH2b S CAA TCA GGA ACC TTC GGA ACA C
  A GTC CTG GCC TCT GAG AGC AT
  P TGC TGA AGG ACA CAC AGC TGC ACC T
Murine Myf5 S CAG CCC CAC CTC CAA CTG
  A GCA GCA CAT GCA TTT GAT ACA TC
  P TGT CTG GTC CCG AAA GAA CAG CAG CTT
Murine MYHembryonic S TCC GAC AAC GCC TAC CAG TT
  A CCC GGA TTC TCC GGT GAT
  P ATG CTG ACT GAT CGT GAG AAC CAG TCT ATC CT
Murine MYHperinatal S GGA GGC CAG GGT ACG TGA A
  A GAG CAC ATT CTT GCG GTC TTC
  P AGG AAC TTA CCT ACC AGA CTG
Murine α-actin S GAG CGT GGC TAT TCC TTC GT
  A CAC ATA GCA CAG CTT CTC TTT GAT
  P CGC GCA CAA TCT CAC GTT CAG CTG
Murine β-actin S CGT GAA AAG ATG ACC CAG ATC A
  A CAC AGC CTG GAT GGC TAC GT
  P TTG AGA CCT TCA ACA CCC CAG CCA TG
  1. S, sense; A, antisense; P, TaqMan probe. All probes were 5' labelled with FAM, and 3' labelled with TAMRA.