Skip to main content

Table 4 Markers used in linkage analysis of SSC3

From: Molecular characterization and exclusion of porcine GUSBas a candidate gene for congenital hernia inguinalis/scrotalis

Marker name Sequence of forward primer (5'–3') Sequence of reverse primer (5'–3') TAnn(°C) Alleles
SW274 cgcacagcgacatcttttta aagtgcagccctaaaaagaca 55 9
SW2021 gcgacacatgagataaaactgc aatccacaggcttactcagatg 56 14
SW2429 tctttttagggtgaggatgg catgtcccctatgaactctgtg 58 7
SW833 ctgctgttttgctgcagtg tccactgaggtctctcactctc 58 5
SW72 atcagaacagtgcgcccgt tttgaaaatggggtgttcc 50 6
SE51018 tctaaacaaagggcaggtgg ggacttccatatgctgtggg 51 10
S0701 gcagagtgattcagttatac tcatcttccctaccacc 60 3
S0206 tgggtgtggtcaacaaccaa acgtgcctgcctctaccatc 57 7
SW2408 agacacttgtagtcgctcctcc agacaaaaggggatgccac 57 13
S0002 gaagccaaagagacaactgc gttctttacccactgagcca 56 13
S0397 ggctaattggagctgagaagca agtgcagcatttccgataactctg 54 12
SW1327 agctcttgaagctcaaagacg catacttctccaggaggaaagc 54 8
SW349 cctgttgtaggctccatgag ctaggagtcggccctgaac 53 11