Skip to main content

Table 2 Primer sequences for amplification of ORF3 and ORF5 genes from PRRSV strain LV

From: Construction and immunogenicity of a DNA vaccine coexpressing GP3 and GP5 of genotype-I porcine reproductive and respiratory syndrome virus

Name Sequence (5′ → 3′)
P1 CGCGGATCCGCTCATCAGTGTGCACGCTTCCAT
P2 CCCAAGCTTTCGTGATGTACTGGGGAGTACCG
P3 CGGGATCCGGCAACGGCGACAGCTC
P4 CCCTCGAGGGCCTCCCATTGCTCAG
P5 CGCGGATCCAGATGTTCTCACAAATTGGGGCGTT
P6 CCCAAGCTTGGCCTCCCATTGCTCAGCCG
P7 CGCGGATCCGGAGGCGGAGGCTCCGGAGGAGGAGGCTCCGGAGGCGGAGGGTCTAGATGTTCTCACAAATTGGGGCGTT
  1. Primers P1/P2 were for full-length ORF3; P3/P4 were for ORF5 lacking the signal peptide; primers P5/P6 were for full-length ORF5, primer P7 was for the full-length sequence of ORF5; the italics part encodes the G4S flexible Linker.