Table 4 Primers used for the detection of bovine coronavirus N-nucleocapsid, primers used for the detection of rotavirus VP1 viral protein-coding gene group A, fusion temperatures (Tm) and their amplicons (in base pairs)
Virus | Primer | Sequence 5′-3’ | Location | T° melting | Amplicons | |
|---|---|---|---|---|---|---|
BCoV | BCOV1 (Sense) | AAGAGCTCAAYCCAAGCAAATGY | 123–146 | 60 °C | 463 pb | |
BCOV2 (Antisense) | AGCAGACCTTCCTGAGCCTTCAAT | 562–585 | 60 °C | 463 pb | ||
BCOV3(Antisense) | TCAATRTCGGTGCCATACTGGTCT | 405–428 | 59,9 °C | 306pb (withBCoV1) | ||
BoRVA | ROT1 (Sense) | CTCTGGCAAARCTGGTGTCA | 737–753 | 59,7 °C | 492 PB | |
ROT2 (Antisense) | CATTCGACGCTGATGACATY | 1206–1225 | 59,7 °C | 492 PB | ||
ROT3(Antisense) | ARCAATCRACCAACCASTCCTGTA | 938–961 | 59,8 °C | 228pb (with ROT1) | ||