Skip to main content

Table 3 Primers used in this study 

From: The host micro-RNA cfa-miR-346 is induced in canine leishmaniasis

Target mRNA Accession number Forward primer (5’-3’) Reverse primer (5’-3’)
Atf3 XM_022420880.1 TTCGCCATCCAGAACAAGCA GGGCTACCTCAGTTTTCGTG
Atf4 XM_854584.5 TTCTCCAGCGACAAGGCTAA AAGGCATCCTCCTTTCCGTTG
Ddit3 (Chop) XM_014117187.2 CTGGAAACAAGGAGGAAGAATCA GGCTCTGGAAGGTGTTCGTG
Grid1 XM_022417615.1 TACAGCAAGGTGGCGAATCCT AGGAGCACACAATGAGGGTGA
Hspa5 XM_858292.5 TGGCATAAACCCAGACGAGG AGGGGACATACATCAAGCAGT
sXbp1 XM_849540.5 CTGAGTCCGCAGCAGGT TGAACAGAATGCCCAACAGG
uXbp1 XM_849540.5 CCGCAGCACTCAGACTACG TGAACAGAATGCCCAACAGG
Gapdh NM_001003142.2 GTCCCCACCCCCAATGTATC TCCGATGCCTGCTTCACTAC
  1. Atf3 Canis lupus familiaris activating transcription factor 3, Atf4 Canis lupus familiaris activating transcription factor 4, Ddit3 Canis lupus familiaris DNA damage inducible transcript 3, Grid1 Canis lupus familiaris glutamate ionotropic receptor delta type subunit 1, Hspa5 Canis lupus familiaris heat shock protein family A (Hsp70) member 5, sXbp1 Canis lupus familiaris X-box binding protein 1 (spliced), uXbp1 Canis lupus familiaris X-box binding protein 1 (unspliced), Gapdh Canis lupus familiaris glyceraldehyde-3-phosphate dehydrogenase