Skip to main content

Table 1 Sequences of primer used for qRT-PCR

From: Lactobacillus plantarum 17–5 attenuates Escherichia coli-induced inflammatory responses via inhibiting the activation of the NF-κB and MAPK signalling pathways in bovine mammary epithelial cells

Gene Primer sequence (5′-3′) Product sizes (bp) GenBank accession no.
TLR2 CATTCCCTGGCAAGTGGATTATC 201 AY634629
GGAATGGCCTTCTTGTCAATGG
TLR4 AGCTTCAACCGTATCATGGCCTCT 166 NM_174198.6
ACTAAGCACTGGCATGTCCTCCAT
MyD88 AAGTACAAGCCAATGAAGAAAGAG 102 NM_001014382.2
GAGGCGAGTCCAGAACCAG
IL-1β CCTCGGTTCCATGGGAGATG 119 NM_174093.1
AGGCACTGTTCCTCAGCTTC
IL-6 TGAAAGCAGCAAGGAGACACT 90 NM_173923.2
TGATTGAACCCAGATTGGAAGC
TNF-α GGGCTTTACCTCATCTACTCACAG 132 NM_173966.3
GATGGCAGACAGGATGTTGACC
IL-8 ACACATTCCACACCTTTCCAC 149 AF232704
ACCTTCTGCACCCACTTTTC
COX-2 GGTGCCTGGTCTGATGATGT 124 NM_174445.2
GATTAGCCTGCTTGTCTGGA
iNOS TGTCAGCGGCAAGCACCACATT 289 NM_001076799.1
CGGCTGGTTGCATGGGAAAACT
CXCL-2 ACCGAAGTCATAGCCACTCTC 218 NM_174299.3
TCCAGATGGCCTTAGGAGGT
CXCL-10 CTCGAACACGGAAAGAGGCA 117 NM_001046551
TCCACGGACAATTAGGGCTT
GAPDH CACCCTCAAGATTGTCAGCA 103 NM_001034034.2
GGTCATAAGTCCCTCCACGA