Skip to main content

Table 8 G. gallus genes, housekeeping genes for chickens and their specific primers used in RT-qPCR analysis

From: Broiler responses to copper levels and sources: growth, tissue mineral content, antioxidant status and mRNA expression of genes involved in lipid and protein metabolism

Genes Description Sequence 5 ' → 3' Function
FAS Fatty Acid Synthetase Fw: AGCGTGCTATGCTTGCC
Rv: GTCCGTGACGAATTGCTTTAT
Lipid metabolism
LPL Lipoprotein lipase Fw: TACAGTCTGGGTGCTCAT
Rv: GCATACTCAAAGGTGGG
Lipid metabolism
MDH Malate dehydrogenase Fw: AAAGACTGTGAAGGTGGTAG
Rv: ATCCAAGCGAGTCAAGC
Lipid metabolism
CuZnSOD Superoxide dismutase copper-zinc Fw: GGAGGAGTGGCAGAAGT
Rv: TAAACGAGGTCCAGCAT
Antioxidant defense system
MT Metallothionein Fw: AAGGGCTGTGTCTGCAAGGA
Rv: CTTCATCGGTATGGAAGGTACAAA
Storage and transportation
mTOR Mechanistic target of rapamycin Fw: GGCAATCAGTGTGCCTACCT
Rv: GGCAGGCTCTTAAGGCAGAA
Protein Metabolism
GSK 3B Glycogen synthase kinase Fw: GGGCTGTGTATTGGCTGAAC
Rv: GTAGGCGTTCCCAGAACCTT
Protein Metabolism
AKT 1 Protein kinase serine-threonine 1 Fw: ACGCTGACAGAAAACCGTGT
Rv: ACAACTCCCCTCCGTTAGCA
Protein Metabolism
SLC31A1 (CTR1) Copper transporter 1 Fw: CATCTTCAGGAGGTGGTCAT
Rv: CAACGGCACATTCTCATAGC
Copper transporter
ATOX1 Antioxidant target 1 copper chaperone Fw: AGATGTCGGAAAGGAGAGG
Rv: AGAAGCAGCACCTCGAT
Copper Intracellular transporter
STEAP1 Transmembrane Epithelial Antigene of the Prostate 1 Fw: CCTATTGTGGTCCTGCTCT
Rev: AGCTTCCCAACCACATCT
Reduce Cu2+ to Cu1+
β-actin Β-actin protein Fw: GAGAAATTGTGCGTGACATCA
Rv: CCTGAACCTCTCATTGCCA
Housekeeping gene
GAPDH Glyceraldehyde-3-phosphate dehydrogenase Fw: CAAGTGGACATTGTCGCCATCA
Rv: GCTTCCCATTCTCAGCCTGACT
Housekeeping gene
  1. Abbreviations: Fw Forward, Rv Reverse (5′ → 3′)