Skip to main content

Table 1 Primer sequences for quantitative real-time polymerase chain reaction

From: β-defensin 118 attenuates inflammation and injury of intestinal epithelial cells upon enterotoxigenic Escherichia coli challenge

Genea Primer sequence (5′-3′) Accession Number.
IL-1β Forward: AAAGCCCAATTCAGGGACCCTAC
Reverse: CCATCACTTCCTTGGCGGGTT
NM_214055.1
IL-6 Forward: AGGGAAATGTCGAGGCTGTGC
Reverse: CCGGCATTTGTGGTGGGGTT
NM_214399.1
TNF-α Forward: TTCGAGGTTATCGGCCCCCA
Reverse: GTGGGCGACGGGCTTATCTG
NM_214022.1
CASP3 Forward: GGAATGGCATGTCGATCTGGT
Reverse: ACTGTCCGTCTCAATCCCAC
NM_214131.1
CASP8 Forward: TCTGCGGACTGGATGTGATT
Reverse: TCTGAGGTTGCTGGTCACAC
NM_001031779.2
CASP9 Forward: AATGCCGATTTGGCTTACGT
Reverse: CATTTGCTTGGCAGTCAGGTT
XM_003127618.4
β-actin Forward: TGGAACGGTGAAGGTGACAGC
Reverse: GCTTTTGGGAAGGCAGGGACT
XM_003124280.5
  1. a IL-1β interleukin-1β, IL-6 interleukin-6, TNF-α tumour necrosis factor-α, CASP3 caspase 3, CASP8 caspase 8, CASP9 caspase 9, β-actin, beta-actin