Skip to main content

Table 2 Primers used to amplify the mecA gene

From: Nasal carriage of Methicillin-Resistant Staphylococcus aureus among sympatric free-ranging domestic pigs and wild Chlorocebus pygerythrus in a rural African setting

Primers 5’ – 3’

5’ – 3’ primer sequence

Amplicon size

mecA forward primer

TCCAGATTACAACTTCACCAGG

162 bp

mecA reverse primer

CCACTTCATATCTTGTAACG

 
Back to article page

BMC Veterinary Research

ISSN: 1746-6148

Contact us