Skip to main content

Table 1 Primers used in this study

From: Molecular identification and functional characterization of IRF4 from common carp (Cyprinus carpio. L) in immune response: a negative regulator in the IFN and NF-κB signalling pathways

Primer Sequence(5′-3′) Application
ccIRF4-F GGAGCCAGCTGGACATCTC Cloning for IRF4
ccIRF4-R CAGGAGCTGCCTGGCGAAC Cloning for IRF4
ccIRF4-5Rout CGTCATCTGAGGCTGTAGAGGAGG Cloning for IRF4
ccIRF4-5Rin GAGCCTCTCTTGGCTCCTTCTGG Cloning for IRF4
ccIRF4-3Fout GGACACGCAGCAGTTCCTCTCAG Cloning for IRF4
ccIRF4-3Fin GCCACGCTCTCAGGTGGTGCTGTG Cloning for IRF4
ccIRF4-Frt CCAATATGAGATCCGCCGAAGCC Rea-ltime PCR
ccIRF4-Rrt CCTGGAGACGAAGAGGAGGAGATG Rea-ltime PCR
ccS11-F CCGTGGGTGACATCGTTACA Rea-ltime PCR
ccS11-R TCAGGACATTGAACCTCACTGTCT Rea-ltime PCR
ccIRF4-F-EI CCGGAATTCATGAACTTAGATGGGGACAGCAGC Recombinant plasmid
ccIRF4-R-SII TCCCCGCGGCACCTGCAAGTGCTGGATGCT Recombinant plasmid
EPC-IFN-F CGCTAAGGTGGAGGACCAGGTTA Rea-ltime PCR
EPC-IFN-R TTAGGTTCCATTGTGCTGCGTTCA Rea-ltime PCR
EPC-viperin-F AAGACTTCCTGGACCGCCATAAGA Rea-ltime PCR
EPC-viperin-R CCTCTCGGCAATCCAAGAAGCG Rea-ltime PCR
EPC-PKR-F TGGAGACTTCGGCCTCGTGACT Rea-ltime PCR
EPC-PKR-R TCGCTTGCTCCGGGCTCATGTA Rea-ltime PCR
EPC-IL-1β-F CCCAGACCAATCTCTACCTCGCT Rea-ltime PCR
EPC-IL-1β-R GAGGAGGTTGTCATTCTGGTCACC Rea-ltime PCR
EPC-β-actin-F GCCGTGACCTGACTGACTACCT Rea-ltime PCR
EPC-β-actin-R GCCACATAGCAGAGCTTCTCCTTG Rea-ltime PCR