Skip to main content

Table 2 Subtyping of C. felis isolates using reference positions based on gp60 gene

From: Molecular prevalence and subtyping of Cryptosporidium spp. in fecal samples collected from stray cats in İzmir, Turkey

Sample R1
(463–556)
Deletion
(667–679)
Indel
(706–711)
R2
(770–910)
Indel
(1015–1068)
Indel
(1156–1167)
Subtype family
C. felis cat isolate 1 1 copy 9 bp - 2 copy - 4 GGT XIXa
C. felis cat isolate 2 1 copy 9 bp - 1 copy - a XIXa
C. felis cat isolate 3 1 copy 9 bp - 2 copy - a XIXa
C. felis cat isolate 4 1 copy 9 bp - 2 copy - a XIXa
C. felis cat isolate 5 1 copy 9 bp - 2 copy - 3 GGT XIXa
C. felis cat isolate 6 1 copy 9 bp - 1 copy - 4 GGT XIXa
C. felis cat isolate 7 1 copy 9 bp - 1 copy - 4 GGT XIXa
C. felis cat isolate 8 1 copy 9 bp - 1 copy - 2 GGT XIXa
C. felis cat isolate 9 1 copy 9 bp - 2 copy - 3 GGT XIXa
C. felis cat isolate 10 1 copy 9 bp - 2 copy - 2 GGT XIXa
C. felis cat isolate 11 1 copy 9 bp - 2 copy - 4 GGT XIXa
C. felis cat isolate 12 1 copy 9 bp - 1 copy - 4 GGT XIXa
Reference isolate 1 1–3 copies 3 or 9 bp - 1–4 copies - 2–5 GGT XIXa
Reference isolate 2 1 or 2 copies 6 or 15 bp - 2–4 copies 18 bp 4 GGT XIXb
Reference isolate 3 2 copies 15 bp - 3 copies - 3 GGT XIXc
Reference isolate 4 1 copy - - 1 copy - 4 GGT XIXd
Reference isolate 5 1 copy - 6 bp 1 copy 36 bp 4 GGT XIXe
  1. Reference positions are from Jiang et al. 2020 [26]
  2. ashows the unevaluated sequences because of sequencing errors
  3. R1: 33-bp tandem repeat (CCACCTAGTGGCGGTAGTGGCGTGTCCCCTGCT)
  4. R2: 39-bp tandem repeat (AGCACAACTACGGCTACAGCGAGCACTGCGAGTTCGACA)