Skip to main content

Table 2 Primers and target genes of Trypanosoma spp. investigated [33,34,35,36]

From: Molecular characterization of Trypanosoma evansi, T. vivax and T. congolense in camels (Camelus dromedarius) of KSA

Primers (5′-3′) Target gene Product size (bp) Cycling conditions (same for all primers)
For-Kin: GCGTTCAAAGATTGGGCAAT ITS1 T. evansi (540 bp), T. vivax (300 bp) 94 °C—3 min
94 °C—1 min
58 °C—1 min (× 4)
72 °C—1 min
94 °C—1 min
56 °C—1 min (× 8)
72 °C—1 min
94 °C—1 min
54 °C—1 min (× 23)
72 °C—1 min
72 °C—5 min [37]
Rev-Kin: CGCCCGAAAGTTCACC
For-ILO: GCCACCACGGCGAAAGAC Rotat 1.2 VSG T. evansi (488 bp)
Rev-ILO: TAATCAGTGTGGTGTGC
For-IR: GCTGTAGGTGAACTTGCAGCAGCTGGATCATT ITS T. evansi (1.1 kbp)
Rev-IR: GCGGGTAGTCCTGCCAAACACTCAGGTCTG
For-ITS1: CCGGAAGTTCACCGATATTG ITS1 T. evansi (480 bp), T. vivax (250 bp), T. congolense (620 bp).
Rev-ITS1: TTGCTGCGTTCTTCAACGAA