Skip to main content

Table 2 Oligonucleotide primers used in qRT-PCR analysisa

From: Sophorolipid protects against early-weaning syndrome by improving the gut microenvironment in early-weaned piglets

Gene name Sequence (forward, reverse) Reference
Housekeeping gene
 GAPDH F: 5′- GAGGTCGGAGTGAACGGAT −3’ [16]
R: 5′- CCTGGGTCGAATCATACTGGAACA − 3′
Inflammatory cytokines
 IL-8 F: 5′- TTTCTGCAGCTCTCTGTGAGG −3’ [17]
R: 5′- CTGCTGTTGTTGTTGCTTCTC − 3′
 IFN-γ F: 5′- GTTTTTCTGGCTCTTACTGC − 3’ [18]
R: 5′- CTTCCGCTTTCTTAGGTTAG − 3′
 TNF-α F: 5′- ATCGGCCCCCAGAAGGAAGAG − 3’ [19]
R: 5′- GATGGCAGAGAGGAGGTTGAC − 3′
 IL-10 F: 5′- GCATCCACTTCCCAACCA − 3’ [20]
R: 5′- CTTCCTCATCTTCATCGTCAT − 3′
Tight junction proteins
 ZO-1 F: 5′- AAGCCCTAAGTTCAATCACAATCT − 3’ [21]
R: 5′- ATCAAACTCAGGAGGCGGC − 3′
 OCLD F: 5′- TCCTGGGTGTGATGGTGTTC − 3’ [21]
R: 5′- CGTAGAGTCCAGTCACCGCA − 3′
 CLDN1 F: 5′- TCGACTCCTTGCTGAATCTG − 3’ [16]
R: 5′- TTACCATACCTTGCTGTGGC − 3′
Mucin production
 MUC2 F: 5′- GGCTGCTCATTGAGAGGAGT − 3’ [22]
R: 5′- ATGTTCCCGAACTCCAAGG − 3’
  1. aAbbreviations: CLDN1 claudin-1, GAPDH glyceraldehyde-3-phosphate dehydrogenase, IFN-γ interferon-γ, IL-8 interleukin-8, IL-10 interleukin-10, MUC2 mucin 2, OCLD occludin, TNF-α tumor necrosis factor- α, ZO-1 zona occludens 1