Skip to main content

Table 1 Primers used for detection and/or characterization of Anaplasma species in the present study

From: Molecular evidence of Anaplasma phagocytophilum in olive baboons and vervet monkeys in Kenya

Assay Primer Sequence 5′ to 3′ Target gene Amplicon size (bp) References
Conventional
PCR
EHR16SD
EHR16SR
GGTACCYACAGAAGAAGTCC
TAGCACTCATCGTTTACAGC
16S rRNA 345 [3]