Skip to main content

Table 1 Sequences of primers used in qPCR

From: Assessment of gentamicin and cisplatin-induced kidney damage mediated via necrotic and apoptosis genes in albino rats

Gene Accession no Direction Primer sequence
Bcl2 L14680 Sense GACTTCGCCGAGATGTCCAG
Antisense GTGCAGGTGCCGGTTCAGG
Bax U49729 Sense AGGTCTTTTTCCGAGTGGCAGC
Antisense CCGGAGGAAGTCCAATGTCC
Caspase 3 GCA-00000189504 Sense GGTATTGAGACAGACAGTGG
Antisense CATGGGATCTGTTTCTTTGC
TNF-a GCA-00000189504 Sense AAATGGGCTCCCTCTCATCAGTTC
Antisense TCTGCTTGGTGGTTTGCTACGAC
β-actin V01217 Sense GGACCTGACAGACTACC
Antisense GGCATAGAGGTCTTTACGG